Enoyl-ACP Reductase cDNA ORF Clone, E. coli, C-HA tag

Cat: EG30001-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Enoyl-ACP Reductase Reagents
CRO Services
Product recommended

All Enoyl-ACP Reductase Reagents
Enoyl-ACP Reductase cDNA ORF Clone, E. coli, C-HA tag General Information
Gene
Species
E. coli
RefSeq ORF Size
789 bp
Description
Full length Clone DNA of E. coli enoyl-[acyl-carrier-protein] reductase, NADH-dependent with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Enoyl-ACP Reductase cDNA ORF Clone, E. coli, C-HA tag Alternative Names
b1288 cDNA ORF Clone, E. coli;ECK1283 cDNA ORF Clone, E. coli;envM cDNA ORF Clone, E. coli;gts cDNA ORF Clone, E. coli;JW1281 cDNA ORF Clone, E. coli;qmeA cDNA ORF Clone, E. coli
Enoyl-ACP Reductase Background Information

Enoyl-ACP reductase, also known as NADH-dependent enoyl-ACP reductase and FABI, is a cell inner membrane and peripheral membrane protein which belongs to the short-chain dehydrogenases/reductases (SDR) family and FabI subfamily. Microorganisms produce many kinds of antibiotics which function in an antagonistic capacity in nature where they have much competition. Bacterial FAS provides essential fatty acids for use in the assembly of key cellular components. Among them, FABI is an enoyl-ACP reductase which catalyzes the final and rate-limiting step of bacterial FAS. The antibiotic diazaborine interferes with the activity by binding to the protein. FABI is a potential target for selective antibacterial action, because it shows low overall sequence homology with mammalian enzymes. Various compounds have been reported as inhibitors of bacterial FabI-inhibitory compounds.

References
  • Miller, WH. et al., 2002, J Med Chem  45 (15):3246-56. 
  • Kitagawa, H. et al., 2007, Bioorg Med Chem  15 (2):1106-16.
  • Zheng, C.J. et al., 2007, Biochem Biophys Res Commun 362 (4):1107-12.
  • Lu,H. et al., 2008, Acc Chem Res 41 (1):11-20.
  • Zheng,CJ. et al., 2009, J Antimicrob Chemother 63 (5):949-53.
  • info info
    添加购物车成功! 添加购物车失败!