UCHL1 cDNA ORF Clone, Cynomolgus, untagged

Cat: CG90725-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All UCHL1 Reagents
CRO Services
Product recommended

All UCHL1 Reagents
UCHL1 cDNA ORF Clone, Cynomolgus, untagged General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
672 bp
Description
Full length Clone DNA of Cynomolgus ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

UCHL1 Background Information

Ubiquitin carboxyl-terminal hydrolase isozyme L1, also known as UCH-L1, Ubiquitin thioesterase L1, PGP9.5 and UCHL1, is a deubiqutinating enzyme with important functions in recycling of ubiquitin. Regulated proteolysis by the ubiquitin pathway has been implicated in control of the cell cycle, transcriptional activation, cell fate and growth, and synaptogenesis. The ubiquitin-proteasome system is involved in synaptic plasticity and is proposed to be part of a molecular switch that converts short-term synaptic potentiation to long-term changes in synaptic strength. UCHL1 is found in neuronal cell bodies and processes throughout the neocortex (at protein level). It is expressed in neurons and cells of the diffuse neuroendocrine system and their tumors. UCHL1 is weakly expressed in ovary. UCHL1 is a ubiquitin-protein hydrolase. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin. UCHL1 also binds to free monoubiquitin and may prevent its degradation in lysosomes. The homodimer of UCHL1 may have ATP-independent ubiquitin ligase activity. UCHL1 dysfunction has been associated with neurodegeneration in Parkinson's, Alzheimer's, and Huntington's disease patients. Reduced UCHL1 function may jeopardize the survival of CNS neurons.

Full Name
ubiquitin carboxyl-terminal esterase L1 (ubiquitin thiolesterase)
References
  • Wada H., et al., 1998, Biochem. Biophys. Res. Commun. 251:688-92.
  • Choi J., et al., 2004, J. Biol. Chem. 279:13256-64.
  • Lombardino,A.2005, et al., J.Proc Natl Acad Sci.USA102 (22):8036-41
  • Okochi-Takada,E. et al., 2006, Int J Cancer. 119 (6):1338-44.
  • Zetterberg, M. et al., 2010, Mol Neurodegener  5 :11.
  • UCHL1 cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    UCHL1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90725-G
    UCHL1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90725-ACG
    UCHL1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90725-ACGLN
    UCHL1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90725-ANG
    UCHL1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90725-ACR
    UCHL1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90725-ANR
    UCHL1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90725-CF
    UCHL1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90725-NF
    UCHL1 cDNA ORF Clone, Cynomolgus, C-His tag CG90725-CH
    UCHL1 cDNA ORF Clone, Cynomolgus, N-His tag CG90725-NH
    UCHL1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90725-CY
    UCHL1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90725-NY
    UCHL1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90725-CM
    UCHL1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90725-NM

    UCHL1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    UCHL1 cDNA ORF Clone in Cloning Vector, Canine DG70231-U
    UCHL1 cDNA ORF Clone, Canine, untagged DG70231-UT
    UCHL1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70231-ACG
    UCHL1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70231-ACGLN
    UCHL1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70231-ANG
    UCHL1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70231-ACR
    UCHL1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70231-ANR
    UCHL1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70231-CF
    UCHL1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70231-NF
    UCHL1 cDNA ORF Clone, Canine, C-His tag DG70231-CH
    UCHL1 cDNA ORF Clone, Canine, N-His tag DG70231-NH
    UCHL1 cDNA ORF Clone, Canine, C-HA tag DG70231-CY
    UCHL1 cDNA ORF Clone, Canine, N-HA tag DG70231-NY
    UCHL1 cDNA ORF Clone, Canine, C-Myc tag DG70231-CM
    UCHL1 cDNA ORF Clone, Canine, N-Myc tag DG70231-NM

    UCHL1 cDNA ORF Clone, Rabbit, Related Products

    Product Name Catalog#(PDF)
    UCHL1 cDNA ORF Clone in Cloning Vector, Rabbit TG65015-G
    UCHL1 cDNA ORF Clone, Rabbit, untagged TG65015-UT
    UCHL1 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65015-ACG
    UCHL1 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65015-ANG
    UCHL1 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65015-ACR
    UCHL1 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65015-ANR
    UCHL1 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65015-CF
    UCHL1 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65015-NF
    UCHL1 cDNA ORF Clone, Rabbit, C-His tag TG65015-CH
    UCHL1 cDNA ORF Clone, Rabbit, N-His tag TG65015-NH
    UCHL1 cDNA ORF Clone, Rabbit, C-HA tag TG65015-CY
    UCHL1 cDNA ORF Clone, Rabbit, N-HA tag TG65015-NY
    UCHL1 cDNA ORF Clone, Rabbit, C-Myc tag TG65015-CM
    UCHL1 cDNA ORF Clone, Rabbit, N-Myc tag TG65015-NM

    UCHL1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    UCHL1 cDNA ORF Clone in Cloning Vector, Rat RG80089-G
    UCHL1 cDNA ORF Clone, Rat, untagged RG80089-UT
    UCHL1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80089-ACG
    UCHL1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80089-ACGLN
    UCHL1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80089-ANG
    UCHL1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80089-ACR
    UCHL1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80089-ANR
    UCHL1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80089-CF
    UCHL1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80089-NF
    UCHL1 cDNA ORF Clone, Rat, C-His tag RG80089-CH
    UCHL1 cDNA ORF Clone, Rat, N-His tag RG80089-NH
    UCHL1 cDNA ORF Clone, Rat, C-HA tag RG80089-CY
    UCHL1 cDNA ORF Clone, Rat, N-HA tag RG80089-NY
    UCHL1 cDNA ORF Clone, Rat, C-Myc tag RG80089-CM
    UCHL1 cDNA ORF Clone, Rat, N-Myc tag RG80089-NM
    UCHL1 qPCR Primer Pairs, Rat RP300085

    UCHL1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    UCHL1 cDNA ORF Clone in Cloning Vector, Mouse MG50690-G
    UCHL1 cDNA ORF Clone, Mouse, untagged MG50690-UT
    UCHL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50690-ACGLN
    UCHL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50690-ACG
    UCHL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50690-ANG
    UCHL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50690-ACR
    UCHL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50690-ANR
    UCHL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50690-CF
    UCHL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50690-NF
    UCHL1 cDNA ORF Clone, Mouse, C-His tag MG50690-CH
    UCHL1 cDNA ORF Clone, Mouse, N-His tag MG50690-NH
    UCHL1 cDNA ORF Clone, Mouse, C-HA tag MG50690-CY
    UCHL1 cDNA ORF Clone, Mouse, N-HA tag MG50690-NY
    UCHL1 cDNA ORF Clone, Mouse, C-Myc tag MG50690-CM
    UCHL1 cDNA ORF Clone, Mouse, N-Myc tag MG50690-NM
    UCHL1 qPCR Primer Pairs, Mouse MP200666

    UCHL1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    UCHL1 cDNA ORF Clone in Cloning Vector, Human HG11663-M
    UCHL1 cDNA ORF Clone, Human, untagged HG11663-UT
    UCHL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11663-ACG
    UCHL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11663-ACGLN
    UCHL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11663-ANG
    UCHL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11663-ACR
    UCHL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11663-ANR
    UCHL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11663-CF
    UCHL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11663-NF
    UCHL1 cDNA ORF Clone, Human, C-His tag HG11663-CH
    UCHL1 cDNA ORF Clone, Human, N-His tag HG11663-NH
    UCHL1 cDNA ORF Clone, Human, C-HA tag HG11663-CY
    UCHL1 cDNA ORF Clone, Human, N-HA tag HG11663-NY
    UCHL1 cDNA ORF Clone, Human, C-Myc tag HG11663-CM
    UCHL1 cDNA ORF Clone, Human, N-Myc tag HG11663-NM
    UCHL1 qPCR Primer Pairs, Human HP101444
    info info
    添加购物车成功! 添加购物车失败!