TMEM59 cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90620-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMEM59 Reagents
CRO Services
Product recommended

All TMEM59 Reagents
TMEM59 cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
975 bp
Description
Full length Clone DNA of Rhesus transmembrane protein 59 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMEM59 Background Information
Full Name
transmembrane protein 59

TMEM59 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TMEM59 cDNA ORF Clone in Cloning Vector, Rhesus CG90620-G
TMEM59 cDNA ORF Clone, Rhesus, untagged CG90620-UT
TMEM59 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90620-ACGLN
TMEM59 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90620-ACG
TMEM59 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90620-ACR
TMEM59 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90620-CF
TMEM59 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90620-NF
TMEM59 cDNA ORF Clone, Rhesus, C-His tag CG90620-CH
TMEM59 cDNA ORF Clone, Rhesus, C-HA tag CG90620-CY
TMEM59 cDNA ORF Clone, Rhesus, N-HA tag CG90620-NY
TMEM59 cDNA ORF Clone, Rhesus, C-Myc tag CG90620-CM
TMEM59 cDNA ORF Clone, Rhesus, N-Myc tag CG90620-NM

TMEM59 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TMEM59 cDNA ORF Clone in Cloning Vector, Rat RG81667-G
TMEM59 cDNA ORF Clone, Rat, untagged RG81667-UT
TMEM59 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81667-ACG
TMEM59 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81667-ACGLN
TMEM59 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81667-ANG
TMEM59 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81667-ACR
TMEM59 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81667-ANR
TMEM59 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81667-CF
TMEM59 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81667-NF
TMEM59 cDNA ORF Clone, Rat, C-His tag RG81667-CH
TMEM59 cDNA ORF Clone, Rat, N-His tag RG81667-NH
TMEM59 cDNA ORF Clone, Rat, C-HA tag RG81667-CY
TMEM59 cDNA ORF Clone, Rat, N-HA tag RG81667-NY
TMEM59 cDNA ORF Clone, Rat, C-Myc tag RG81667-CM
TMEM59 cDNA ORF Clone, Rat, N-Myc tag RG81667-NM

TMEM59 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMEM59 cDNA ORF Clone in Cloning Vector, Mouse MG53658-U
TMEM59 cDNA ORF Clone, Mouse, untagged MG53658-UT
TMEM59 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53658-ACG
TMEM59 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53658-ACGLN
TMEM59 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53658-ACR
TMEM59 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53658-CF
TMEM59 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53658-NF
TMEM59 cDNA ORF Clone, Mouse, C-His tag MG53658-CH
TMEM59 cDNA ORF Clone, Mouse, N-His tag MG53658-NH
TMEM59 cDNA ORF Clone, Mouse, C-HA tag MG53658-CY
TMEM59 cDNA ORF Clone, Mouse, N-HA tag MG53658-NY
TMEM59 cDNA ORF Clone, Mouse, C-Myc tag MG53658-CM
TMEM59 cDNA ORF Clone, Mouse, N-Myc tag MG53658-NM

TMEM59 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMEM59 cDNA ORF Clone in Cloning Vector, Human HG16362-G
TMEM59 cDNA ORF Clone, Human, untagged HG16362-UT
TMEM59 cDNA ORF Clone, Human, C-GFPSpark® tag HG16362-ACG
TMEM59 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16362-ACGLN
TMEM59 cDNA ORF Clone, Human, C-OFPSpark® tag HG16362-ACR
TMEM59 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16362-CF
TMEM59 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16362-NF
TMEM59 cDNA ORF Clone, Human, C-His tag HG16362-CH
TMEM59 cDNA ORF Clone, Human, N-His tag HG16362-NH
TMEM59 cDNA ORF Clone, Human, C-HA tag HG16362-CY
TMEM59 cDNA ORF Clone, Human, N-HA tag HG16362-NY
TMEM59 cDNA ORF Clone, Human, C-Myc tag HG16362-CM
TMEM59 cDNA ORF Clone, Human, N-Myc tag HG16362-NM
TMEM59 qPCR Primer Pairs, Human HP105113
info info
添加购物车成功! 添加购物车失败!