TMED3 cDNA ORF Clone, Rhesus, N-His tag

Cat: CG90617-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TMED3 Reagents
CRO Services
Product recommended

All TMED3 Reagents
TMED3 cDNA ORF Clone, Rhesus, N-His tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
660 bp
Description
Full length Clone DNA of Rhesus transmembrane emp24 protein transport domain containing 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TMED3 Background Information
Full Name
transmembrane emp24 protein transport domain containing 3

TMED3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
TMED3 cDNA ORF Clone in Cloning Vector, Rhesus CG90617-G
TMED3 cDNA ORF Clone, Rhesus, untagged CG90617-UT
TMED3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90617-ACGLN
TMED3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90617-ACG
TMED3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90617-ACR
TMED3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90617-CF
TMED3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90617-NF
TMED3 cDNA ORF Clone, Rhesus, C-His tag CG90617-CH
TMED3 cDNA ORF Clone, Rhesus, C-HA tag CG90617-CY
TMED3 cDNA ORF Clone, Rhesus, N-HA tag CG90617-NY
TMED3 cDNA ORF Clone, Rhesus, C-Myc tag CG90617-CM
TMED3 cDNA ORF Clone, Rhesus, N-Myc tag CG90617-NM

TMED3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TMED3 cDNA ORF Clone in Cloning Vector, Mouse MG53197-G
TMED3 cDNA ORF Clone, Mouse, untagged MG53197-UT
TMED3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53197-ACGLN
TMED3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53197-ACG
TMED3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53197-ACR
TMED3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53197-CF
TMED3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53197-NF
TMED3 cDNA ORF Clone, Mouse, C-His tag MG53197-CH
TMED3 cDNA ORF Clone, Mouse, N-His tag MG53197-NH
TMED3 cDNA ORF Clone, Mouse, C-HA tag MG53197-CY
TMED3 cDNA ORF Clone, Mouse, N-HA tag MG53197-NY
TMED3 cDNA ORF Clone, Mouse, C-Myc tag MG53197-CM
TMED3 cDNA ORF Clone, Mouse, N-Myc tag MG53197-NM

TMED3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TMED3 cDNA ORF Clone in Cloning Vector, Human HG13233-G
TMED3 cDNA ORF Clone, Human, untagged HG13233-UT
TMED3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13233-ACGLN
TMED3 cDNA ORF Clone, Human, C-GFPSpark® tag HG13233-ACG
TMED3 cDNA ORF Clone, Human, C-OFPSpark® tag HG13233-ACR
TMED3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13233-CF
TMED3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13233-NF
TMED3 cDNA ORF Clone, Human, C-His tag HG13233-CH
TMED3 cDNA ORF Clone, Human, N-His tag HG13233-NH
TMED3 cDNA ORF Clone, Human, C-HA tag HG13233-CY
TMED3 cDNA ORF Clone, Human, N-HA tag HG13233-NY
TMED3 cDNA ORF Clone, Human, C-Myc tag HG13233-CM
TMED3 cDNA ORF Clone, Human, N-Myc tag HG13233-NM
TMED3 qPCR Primer Pairs, Human HP101945
info info
添加购物车成功! 添加购物车失败!