TALDO1 cDNA ORF Clone, Cynomolgus, N-Myc tag

Cat: CG90814-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All TALDO1 Reagents
CRO Services
Product recommended

All TALDO1 Reagents
TALDO1 cDNA ORF Clone, Cynomolgus, N-Myc tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
657 bp
Description
Full length Clone DNA of Cynomolgus transaldolase 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TALDO1 Background Information
Full Name
transaldolase 1

TALDO1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
TALDO1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90814-G
TALDO1 cDNA ORF Clone, Cynomolgus, untagged CG90814-UT
TALDO1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90814-ACGLN
TALDO1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90814-ACG
TALDO1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90814-ANG
TALDO1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90814-ACR
TALDO1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90814-ANR
TALDO1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90814-CF
TALDO1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90814-NF
TALDO1 cDNA ORF Clone, Cynomolgus, C-His tag CG90814-CH
TALDO1 cDNA ORF Clone, Cynomolgus, N-His tag CG90814-NH
TALDO1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90814-CY
TALDO1 cDNA ORF Clone, Cynomolgus, N-HA tag CG90814-NY
TALDO1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90814-CM

TALDO1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TALDO1 cDNA ORF Clone in Cloning Vector, Rat RG80805-U
TALDO1 cDNA ORF Clone, Rat, untagged RG80805-UT
TALDO1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80805-ACGLN
TALDO1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80805-ACG
TALDO1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80805-ANG
TALDO1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80805-ACR
TALDO1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80805-ANR
TALDO1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80805-CF
TALDO1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80805-NF
TALDO1 cDNA ORF Clone, Rat, C-His tag RG80805-CH
TALDO1 cDNA ORF Clone, Rat, N-His tag RG80805-NH
TALDO1 cDNA ORF Clone, Rat, C-HA tag RG80805-CY
TALDO1 cDNA ORF Clone, Rat, N-HA tag RG80805-NY
TALDO1 cDNA ORF Clone, Rat, C-Myc tag RG80805-CM
TALDO1 cDNA ORF Clone, Rat, N-Myc tag RG80805-NM
TALDO1 qPCR Primer Pairs, Rat RP300769

TALDO1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
TALDO1 cDNA ORF Clone in Cloning Vector, Mouse MG52084-G
TALDO1 cDNA ORF Clone, Mouse, untagged MG52084-UT
TALDO1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52084-ACGLN
TALDO1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52084-ACG
TALDO1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52084-ANG
TALDO1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52084-ACR
TALDO1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52084-ANR
TALDO1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52084-CF
TALDO1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52084-NF
TALDO1 cDNA ORF Clone, Mouse, C-His tag MG52084-CH
TALDO1 cDNA ORF Clone, Mouse, N-His tag MG52084-NH
TALDO1 cDNA ORF Clone, Mouse, C-HA tag MG52084-CY
TALDO1 cDNA ORF Clone, Mouse, N-HA tag MG52084-NY
TALDO1 cDNA ORF Clone, Mouse, C-Myc tag MG52084-CM
TALDO1 cDNA ORF Clone, Mouse, N-Myc tag MG52084-NM
TALDO1 qPCR Primer Pairs, Mouse MP201957

TALDO1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TALDO1 cDNA ORF Clone in Cloning Vector, Human HG17022-U
TALDO1 cDNA ORF Clone, Human, untagged HG17022-UT
TALDO1 cDNA ORF Clone, Human, C-GFPSpark® tag HG17022-ACG
TALDO1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17022-ACGLN
TALDO1 cDNA ORF Clone, Human, N-GFPSpark® tag HG17022-ANG
TALDO1 cDNA ORF Clone, Human, C-OFPSpark® tag HG17022-ACR
TALDO1 cDNA ORF Clone, Human, N-OFPSpark® tag HG17022-ANR
TALDO1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17022-CF
TALDO1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17022-NF
TALDO1 cDNA ORF Clone, Human, C-His tag HG17022-CH
TALDO1 cDNA ORF Clone, Human, N-His tag HG17022-NH
TALDO1 cDNA ORF Clone, Human, C-HA tag HG17022-CY
TALDO1 cDNA ORF Clone, Human, N-HA tag HG17022-NY
TALDO1 cDNA ORF Clone, Human, C-Myc tag HG17022-CM
TALDO1 cDNA ORF Clone, Human, N-Myc tag HG17022-NM
info info
添加购物车成功! 添加购物车失败!