alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, untagged

Cat: CG90719-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All alpha 1 Antichymotrypsin Reagents
CRO Services
Product recommended

All alpha 1 Antichymotrypsin Reagents
alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, untagged General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1272 bp
Description
Full length Clone DNA of Cynomolgus serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

alpha 1 Antichymotrypsin Background Information

SerpinA3, also known as Alpha 1-antichymotrypsin (AACT), is a plasma alpha globulin glycoprotein, and is a member of serpin superfamily of the serine protease inhibitors consisting of at least 35 members. SerpinA3 has been demonstrated to inhibit the activity of certain serine proteases, such as cathepsin G found in neutrophils, and chymases present in mast cells, by inducing a major conformational rearrangement, and thus protects some tissues from damage caused by proteolytic enzymes. This enzyme is produced primarily in the liver, and is identified as an acute-phase inflammatory protein. SerpinA3 deficiency has been associated with liver disease, and mutations of this gene have been observed in patients with Parkinson disease and chronic obstructive pulmonary disease. In addition, ACT gene polymorphism has been implicated with Alzheimer’s disease (AD), cerebral amyloid angiopathy (CAA), as well as stroke, since SerpinA3 is a major constituent of the plaques in AD and an inhibitor of amyloid beta peptide degradation.

Full Name
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3
References
  • Nilsson, L.N. et al., 2001, J. Neurosci. 21: 1444-1451.
  • Ikari, Y. et al., 2001, J. Biol. Chem. 276: 11798-11803.
  • Vila, N. et al., 2000, Stroke. 31: 2103-2105
  • Eriksson, S. et al., 1995, Proc. Natl. Acad. Sci. USA. 92: 2313-2317.
  • Skeel, A. et al., 2001, J. Biol. Chem. 276: 21932-21937.
  • alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    alpha 1 Antichymotrypsin cDNA ORF Clone in Cloning Vector, Cynomolgus CG90719-G
    alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90719-ACG
    alpha 1 Antichymotrypsin Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90719-ACGLN
    alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90719-ACR
    alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90719-CF
    alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90719-NF
    alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, C-His tag CG90719-CH
    alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, N-His tag CG90719-NH
    alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, C-HA tag CG90719-CY
    alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, N-HA tag CG90719-NY
    alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, C-Myc tag CG90719-CM
    alpha 1 Antichymotrypsin cDNA ORF Clone, Cynomolgus, N-Myc tag CG90719-NM

    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    alpha 1 Antichymotrypsin cDNA ORF Clone in Cloning Vector, Human HG10307-M
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, untagged HG10307-UT
    alpha 1 Antichymotrypsin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10307-ACGLN
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, C-GFPSpark® tag HG10307-ACG
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, C-OFPSpark® tag HG10307-ACR
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10307-CF
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10307-NF
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, C-His tag HG10307-CH
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, N-His tag HG10307-NH
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, C-HA tag HG10307-CY
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, N-HA tag HG10307-NY
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, C-Myc tag HG10307-CM
    alpha 1 Antichymotrypsin cDNA ORF Clone, Human, N-Myc tag HG10307-NM
    alpha 1 Antichymotrypsin qPCR Primer Pairs, Human HP100350
    info info
    添加购物车成功! 添加购物车失败!