RAB10 cDNA ORF Clone, Cynomolgus, C-HA tag

Cat: CG90400-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All RAB10 Reagents
CRO Services
Product recommended

All RAB10 Reagents
RAB10 cDNA ORF Clone, Cynomolgus, C-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
603 bp
Description
Full length Clone DNA of Cynomolgus RAB10, member RAS oncogene family with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

RAB10 Background Information
Full Name
RAB10, member RAS oncogene family

RAB10 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
RAB10 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90400-G
RAB10 cDNA ORF Clone, Cynomolgus, untagged CG90400-UT
RAB10 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90400-ACGLN
RAB10 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90400-ACG
RAB10 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90400-ANG
RAB10 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90400-ACR
RAB10 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90400-ANR
RAB10 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90400-CF
RAB10 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90400-NF
RAB10 cDNA ORF Clone, Cynomolgus, C-His tag CG90400-CH
RAB10 cDNA ORF Clone, Cynomolgus, N-His tag CG90400-NH
RAB10 cDNA ORF Clone, Cynomolgus, N-HA tag CG90400-NY
RAB10 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90400-CM
RAB10 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90400-NM

RAB10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
RAB10 cDNA ORF Clone in Cloning Vector, Mouse MG5A0287-U
RAB10 cDNA ORF Clone, Mouse, untagged MG5A0287-UT
RAB10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0287-ACG
RAB10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0287-ACGLN
RAB10 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A0287-ANG
RAB10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0287-ACR
RAB10 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A0287-ANR
RAB10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0287-CF
RAB10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0287-NF
RAB10 cDNA ORF Clone, Mouse, C-His tag MG5A0287-CH
RAB10 cDNA ORF Clone, Mouse, N-His tag MG5A0287-NH
RAB10 cDNA ORF Clone, Mouse, C-HA tag MG5A0287-CY
RAB10 cDNA ORF Clone, Mouse, N-HA tag MG5A0287-NY
RAB10 cDNA ORF Clone, Mouse, C-Myc tag MG5A0287-CM
RAB10 cDNA ORF Clone, Mouse, N-Myc tag MG5A0287-NM

RAB10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
RAB10 cDNA ORF Clone in Cloning Vector, Human HG16712-U
RAB10 cDNA ORF Clone, Human, untagged HG16712-UT
RAB10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16712-ACGLN
RAB10 cDNA ORF Clone, Human, C-GFPSpark® tag HG16712-ACG
RAB10 cDNA ORF Clone, Human, N-GFPSpark® tag HG16712-ANG
RAB10 cDNA ORF Clone, Human, C-OFPSpark® tag HG16712-ACR
RAB10 cDNA ORF Clone, Human, N-OFPSpark® tag HG16712-ANR
RAB10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16712-CF
RAB10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16712-NF
RAB10 cDNA ORF Clone, Human, C-His tag HG16712-CH
RAB10 cDNA ORF Clone, Human, N-His tag HG16712-NH
RAB10 cDNA ORF Clone, Human, C-HA tag HG16712-CY
RAB10 cDNA ORF Clone, Human, N-HA tag HG16712-NY
RAB10 cDNA ORF Clone, Human, C-Myc tag HG16712-CM
RAB10 cDNA ORF Clone, Human, N-Myc tag HG16712-NM
info info
添加购物车成功! 添加购物车失败!