TrkC cDNA ORF Clone, Cynomolgus, untagged

Cat: CG90726-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All TrkC Reagents

CRO Services

Product recommended


All TrkC Reagents

TrkC cDNA ORF Clone, Cynomolgus, untagged General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1839 bp
Description
Full length Clone DNA of Cynomolgus neurotrophic tyrosine kinase, receptor, type 3.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TrkC Background Information

NT-3 growth factor receptor also known as neurotrophic tyrosine kinase receptor type 3 or TrkC tyrosine kinase or Trk-C receptor, is a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. TrkC/NTRK3 is widely expressed in the developing and adult nervous system. In later embryonic development, TrkC/NTRK3 is expressed in various structures of the CNS including the caudatoputamen, septal nuclei, cerebellum, and brainstem. Other neurotrophins include nerve growth factor(NGF), neurotrophin-3 and neurotrophin-4. In the PNS, trkC hybridization appears to correlate, both temporally and spatially, with the outgrowth of axons toward their peripheral targets. TrkC/NTRK3 is widely expressed in the three identified branches of the mammalian nervous system and appears to correlate with the expression of NT-3, its cognate ligand. The apparent colocalization of trkC transcripts with NT-3 raises the possibility this neurotrophin exerts its trophic effects by a paracrine and/or autocrine mechanism. Signalling through this kinase leads to cell differentiation and may play a role in the development of proprioceptive neurons that sense body position. Mutations in TrkC encoding gene have been associated with medulloblastomas, secretory breast carcinomas and other cancers.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
neurotrophic tyrosine kinase, receptor, type 3
References
  • Tessarollo L, et al. (1993) trkC, a receptor for neurotrophin-3, is widely expressed in the developing nervous system and in non-neuronal tissues. Development. 118(2): 463-75.
  • Lamballe F, et al. (1994) Developmental expression of trkC, the neurotrophin-3 receptor, in the mammalian nervous system. J Neurosci. 14(1): 14-28.
  • Klein R, et al. (1994) Disruption of the neurotrophin-3 receptor gene trkC eliminates la muscle afferents and results in abnormal movements. Nature. 368(6468): 249-51.
  • TrkC cDNA ORF Clone, Cynomolgus, Related Products

    Product Name Catalog#(PDF)
    TrkC cDNA ORF Clone in Cloning Vector, Cynomolgus CG90726-G
    TrkC cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90726-ACG
    TrkC Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90726-ACGLN
    TrkC cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90726-ACR
    TrkC cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90726-CF
    TrkC cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90726-NF
    TrkC cDNA ORF Clone, Cynomolgus, C-His tag CG90726-CH
    TrkC cDNA ORF Clone, Cynomolgus, N-His tag CG90726-NH
    TrkC cDNA ORF Clone, Cynomolgus, C-HA tag CG90726-CY
    TrkC cDNA ORF Clone, Cynomolgus, N-HA tag CG90726-NY
    TrkC cDNA ORF Clone, Cynomolgus, C-Myc tag CG90726-CM
    TrkC cDNA ORF Clone, Cynomolgus, N-Myc tag CG90726-NM

    TrkC cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    TrkC cDNA ORF Clone in Cloning Vector, Mouse MG50320-G
    TrkC cDNA ORF Clone, Mouse, untagged MG50320-UT
    TrkC cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50320-ACG
    TrkC Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50320-ACGLN
    TrkC cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50320-ACR
    TrkC cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50320-CF
    TrkC cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50320-NF
    TrkC cDNA ORF Clone, Mouse, C-His tag MG50320-CH
    TrkC cDNA ORF Clone, Mouse, N-His tag MG50320-NH
    TrkC cDNA ORF Clone, Mouse, C-HA tag MG50320-CY
    TrkC cDNA ORF Clone, Mouse, N-HA tag MG50320-NY
    TrkC cDNA ORF Clone, Mouse, C-Myc tag MG50320-CM
    TrkC cDNA ORF Clone, Mouse, N-Myc tag MG50320-NM
    TrkC qPCR Primer Pairs, Mouse MP200343

    TrkC cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    TrkC cDNA ORF Clone in Cloning Vector, Human HG10048-M
    TrkC cDNA ORF Clone, Human, untagged HG10048-UT
    TrkC Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10048-ACGLN
    TrkC cDNA ORF Clone, Human, C-GFPSpark® tag HG10048-ACG
    TrkC cDNA ORF Clone, Human, C-OFPSpark® tag HG10048-ACR
    TrkC cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10048-CF
    TrkC cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10048-NF
    TrkC cDNA ORF Clone, Human, C-His tag HG10048-CH
    TrkC cDNA ORF Clone, Human, N-His tag HG10048-NH
    TrkC cDNA ORF Clone, Human, C-HA tag HG10048-CY
    TrkC cDNA ORF Clone, Human, N-HA tag HG10048-NY
    TrkC cDNA ORF Clone, Human, C-Myc tag HG10048-CM
    TrkC cDNA ORF Clone, Human, N-Myc tag HG10048-NM
    TrkC qPCR Primer Pairs, Human HP100090
    info info
    添加购物车成功! 添加购物车失败!