NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, N-HA tag

Cat: CG90414-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All NNAT/Neuronatin Reagents

CRO Services

Product recommended


All NNAT/Neuronatin Reagents

NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, N-HA tag General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
165 bp
Description
Full length Clone DNA of Cynomolgus neuronatin with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

NNAT/Neuronatin Background Information

Full Name
neuronatin

NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
NNAT/Neuronatin cDNA ORF Clone in Cloning Vector, Cynomolgus CG90414-G
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, untagged CG90414-UT
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90414-ACG
NNAT/Neuronatin Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90414-ACGLN
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90414-ANG
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90414-ACR
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90414-ANR
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90414-CF
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90414-NF
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, C-His tag CG90414-CH
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, N-His tag CG90414-NH
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, C-HA tag CG90414-CY
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, C-Myc tag CG90414-CM
NNAT/Neuronatin cDNA ORF Clone, Cynomolgus, N-Myc tag CG90414-NM

NNAT/Neuronatin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
NNAT/Neuronatin cDNA ORF Clone in Cloning Vector, Mouse MG52420-G
NNAT/Neuronatin cDNA ORF Clone, Mouse, untagged MG52420-UT
NNAT/Neuronatin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52420-ACGLN
NNAT/Neuronatin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52420-ACG
NNAT/Neuronatin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52420-ANG
NNAT/Neuronatin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52420-ACR
NNAT/Neuronatin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52420-ANR
NNAT/Neuronatin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52420-CF
NNAT/Neuronatin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52420-NF
NNAT/Neuronatin cDNA ORF Clone, Mouse, C-His tag MG52420-CH
NNAT/Neuronatin cDNA ORF Clone, Mouse, N-His tag MG52420-NH
NNAT/Neuronatin cDNA ORF Clone, Mouse, C-HA tag MG52420-CY
NNAT/Neuronatin cDNA ORF Clone, Mouse, N-HA tag MG52420-NY
NNAT/Neuronatin cDNA ORF Clone, Mouse, C-Myc tag MG52420-CM
NNAT/Neuronatin cDNA ORF Clone, Mouse, N-Myc tag MG52420-NM
NNAT/Neuronatin qPCR Primer Pairs, Mouse MP202293

NNAT/Neuronatin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
NNAT/Neuronatin cDNA ORF Clone, Human, untagged HG19716-UT
info info
添加购物车成功! 添加购物车失败!