MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-Myc tag

Cat: CG90429-CM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All MSRA/Methionine Mulfoxide Reductase A Reagents

CRO Services

Product recommended


All MSRA/Methionine Mulfoxide Reductase A Reagents

MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-Myc tag General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
579 bp
Description
Full length Clone DNA of Cynomolgus methionine sulfoxide reductase A with C terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MSRA/Methionine Mulfoxide Reductase A Background Information

Full Name
methionine sulfoxide reductase A

MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone in Cloning Vector, Cynomolgus CG90429-G
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, untagged CG90429-UT
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90429-ACG
MSRA/Methionine Mulfoxide Reductase A Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90429-ACGLN
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90429-ANG
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90429-ACR
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90429-ANR
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90429-CF
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90429-NF
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-His tag CG90429-CH
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-His tag CG90429-NH
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, C-HA tag CG90429-CY
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-HA tag CG90429-NY
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Cynomolgus, N-Myc tag CG90429-NM

MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone in Cloning Vector, Mouse MG52943-G
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, untagged MG52943-UT
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52943-ACG
MSRA/Methionine Mulfoxide Reductase A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52943-ACGLN
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52943-ACR
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52943-CF
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52943-NF
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-His tag MG52943-CH
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, N-His tag MG52943-NH
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-HA tag MG52943-CY
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, N-HA tag MG52943-NY
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, C-Myc tag MG52943-CM
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Mouse, N-Myc tag MG52943-NM

MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MSRA/Methionine Mulfoxide Reductase A cDNA ORF Clone, Human, untagged HG18386-UT
info info
添加购物车成功! 添加购物车失败!