LMBRD1 cDNA ORF Clone, Rhesus, untagged

Cat: CG90777-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LMBRD1 Reagents
CRO Services
Product recommended

All LMBRD1 Reagents
LMBRD1 cDNA ORF Clone, Rhesus, untagged General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1623 bp
Description
Full length Clone DNA of Rhesus LMBR1 domain containing 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LMBRD1 Background Information
Full Name
LMBR1 domain containing 1

LMBRD1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
LMBRD1 cDNA ORF Clone in Cloning Vector, Rhesus CG90777-G
LMBRD1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90777-ACG
LMBRD1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90777-ACGLN
LMBRD1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90777-ACR
LMBRD1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90777-CF
LMBRD1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90777-NF
LMBRD1 cDNA ORF Clone, Rhesus, C-His tag CG90777-CH
LMBRD1 cDNA ORF Clone, Rhesus, N-His tag CG90777-NH
LMBRD1 cDNA ORF Clone, Rhesus, C-HA tag CG90777-CY
LMBRD1 cDNA ORF Clone, Rhesus, N-HA tag CG90777-NY
LMBRD1 cDNA ORF Clone, Rhesus, C-Myc tag CG90777-CM
LMBRD1 cDNA ORF Clone, Rhesus, N-Myc tag CG90777-NM

LMBRD1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LMBRD1 cDNA ORF Clone in Cloning Vector, Rat RG8A0170-U
LMBRD1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0170-ACGLN

LMBRD1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LMBRD1 cDNA ORF Clone in Cloning Vector, Mouse MG51950-U
LMBRD1 cDNA ORF Clone, Mouse, untagged MG51950-UT
LMBRD1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51950-ACG
LMBRD1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51950-ACGLN
LMBRD1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51950-ANG
LMBRD1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51950-ACR
LMBRD1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51950-ANR
LMBRD1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51950-CF
LMBRD1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51950-NF
LMBRD1 cDNA ORF Clone, Mouse, C-His tag MG51950-CH
LMBRD1 cDNA ORF Clone, Mouse, N-His tag MG51950-NH
LMBRD1 cDNA ORF Clone, Mouse, C-HA tag MG51950-CY
LMBRD1 cDNA ORF Clone, Mouse, N-HA tag MG51950-NY
LMBRD1 cDNA ORF Clone, Mouse, C-Myc tag MG51950-CM
LMBRD1 cDNA ORF Clone, Mouse, N-Myc tag MG51950-NM
LMBRD1 qPCR Primer Pairs, Mouse MP201823

LMBRD1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LMBRD1 cDNA ORF Clone in Cloning Vector, Human HG21394-U
info info
添加购物车成功! 添加购物车失败!