IDH3G cDNA ORF Clone, Cynomolgus, N-HA tag

Cat: CG90412-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IDH3G Reagents
CRO Services
Product recommended

All IDH3G Reagents
IDH3G cDNA ORF Clone, Cynomolgus, N-HA tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1182 bp
Description
Full length Clone DNA of Cynomolgus isocitrate dehydrogenase 3 (NAD+) gamma with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IDH3G Background Information
Full Name
isocitrate dehydrogenase 3 (NAD+) gamma

IDH3G cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
IDH3G cDNA ORF Clone in Cloning Vector, Cynomolgus CG90412-G
IDH3G cDNA ORF Clone, Cynomolgus, untagged CG90412-UT
IDH3G Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90412-ACGLN
IDH3G cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90412-ACG
IDH3G cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90412-ANG
IDH3G cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90412-ACR
IDH3G cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90412-ANR
IDH3G cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90412-CF
IDH3G cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90412-NF
IDH3G cDNA ORF Clone, Cynomolgus, C-His tag CG90412-CH
IDH3G cDNA ORF Clone, Cynomolgus, N-His tag CG90412-NH
IDH3G cDNA ORF Clone, Cynomolgus, C-HA tag CG90412-CY
IDH3G cDNA ORF Clone, Cynomolgus, C-Myc tag CG90412-CM
IDH3G cDNA ORF Clone, Cynomolgus, N-Myc tag CG90412-NM

IDH3G cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IDH3G cDNA ORF Clone in Cloning Vector, Mouse MG52631-G
IDH3G cDNA ORF Clone, Mouse, untagged MG52631-UT
IDH3G Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52631-ACGLN
IDH3G cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52631-ACG
IDH3G cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52631-ANG
IDH3G cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52631-ACR
IDH3G cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52631-ANR
IDH3G cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52631-CF
IDH3G cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52631-NF
IDH3G cDNA ORF Clone, Mouse, C-His tag MG52631-CH
IDH3G cDNA ORF Clone, Mouse, N-His tag MG52631-NH
IDH3G cDNA ORF Clone, Mouse, C-HA tag MG52631-CY
IDH3G cDNA ORF Clone, Mouse, N-HA tag MG52631-NY
IDH3G cDNA ORF Clone, Mouse, C-Myc tag MG52631-CM
IDH3G cDNA ORF Clone, Mouse, N-Myc tag MG52631-NM
IDH3G qPCR Primer Pairs, Mouse MP202502

IDH3G cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IDH3G cDNA ORF Clone in Cloning Vector, Human HG22344-U
IDH3G Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG22344-ACGLN
info info
添加购物车成功! 添加购物车失败!