GOSR2 cDNA ORF Clone, Rhesus, C-HA tag

Cat: CG90394-CY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GOSR2 Reagents

CRO Services

Product recommended


All GOSR2 Reagents

GOSR2 cDNA ORF Clone, Rhesus, C-HA tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Rhesus golgi SNAP receptor complex member 2 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GOSR2 Background Information

Full Name
golgi SNAP receptor complex member 2

GOSR2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
GOSR2 cDNA ORF Clone in Cloning Vector, Rhesus CG90394-G
GOSR2 cDNA ORF Clone, Rhesus, untagged CG90394-UT
GOSR2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90394-ACG
GOSR2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90394-ACGLN
GOSR2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90394-ACR
GOSR2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90394-CF
GOSR2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90394-NF
GOSR2 cDNA ORF Clone, Rhesus, C-His tag CG90394-CH
GOSR2 cDNA ORF Clone, Rhesus, N-His tag CG90394-NH
GOSR2 cDNA ORF Clone, Rhesus, N-HA tag CG90394-NY
GOSR2 cDNA ORF Clone, Rhesus, C-Myc tag CG90394-CM
GOSR2 cDNA ORF Clone, Rhesus, N-Myc tag CG90394-NM

GOSR2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GOSR2 cDNA ORF Clone in Cloning Vector, Mouse MG5A3339-U
GOSR2 cDNA ORF Clone, Mouse, untagged MG5A3339-UT
GOSR2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3339-ACG
GOSR2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A3339-ACGLN
GOSR2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A3339-ANG
GOSR2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A3339-ACR
GOSR2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A3339-ANR
GOSR2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A3339-CF
GOSR2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A3339-NF
GOSR2 cDNA ORF Clone, Mouse, C-His tag MG5A3339-CH
GOSR2 cDNA ORF Clone, Mouse, N-His tag MG5A3339-NH
GOSR2 cDNA ORF Clone, Mouse, C-HA tag MG5A3339-CY
GOSR2 cDNA ORF Clone, Mouse, N-HA tag MG5A3339-NY
GOSR2 cDNA ORF Clone, Mouse, C-Myc tag MG5A3339-CM
GOSR2 cDNA ORF Clone, Mouse, N-Myc tag MG5A3339-NM

GOSR2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GOSR2 cDNA ORF Clone in Cloning Vector, Human HG14375-G
GOSR2 cDNA ORF Clone, Human, untagged HG14375-UT
GOSR2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14375-ACGLN
GOSR2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14375-ACG
GOSR2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14375-ANG
GOSR2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14375-ACR
GOSR2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14375-ANR
GOSR2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14375-CF
GOSR2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14375-NF
GOSR2 cDNA ORF Clone, Human, C-His tag HG14375-CH
GOSR2 cDNA ORF Clone, Human, N-His tag HG14375-NH
GOSR2 cDNA ORF Clone, Human, C-HA tag HG14375-CY
GOSR2 cDNA ORF Clone, Human, N-HA tag HG14375-NY
GOSR2 cDNA ORF Clone, Human, C-Myc tag HG14375-CM
GOSR2 cDNA ORF Clone, Human, N-Myc tag HG14375-NM
GOSR2 qPCR Primer Pairs, Human HP103024
info info
添加购物车成功! 添加购物车失败!