GABARAP cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag

Cat: CG90446-NF

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GABARAP Reagents

CRO Services

Product recommended


All GABARAP Reagents

GABARAP cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
354 bp
Description
Full length Clone DNA of Rhesus GABA(A) receptor-associated protein with N terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GABARAP Background Information

Full Name
GABA(A) receptor-associated protein

GABARAP cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
GABARAP cDNA ORF Clone in Cloning Vector, Rhesus CG90446-G
GABARAP cDNA ORF Clone, Rhesus, untagged CG90446-UT
GABARAP Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90446-ACGLN
GABARAP cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90446-ACG
GABARAP cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90446-ANG
GABARAP cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90446-ACR
GABARAP cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90446-ANR
GABARAP cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90446-CF
GABARAP cDNA ORF Clone, Rhesus, C-His tag CG90446-CH
GABARAP cDNA ORF Clone, Rhesus, N-His tag CG90446-NH
GABARAP cDNA ORF Clone, Rhesus, C-HA tag CG90446-CY
GABARAP cDNA ORF Clone, Rhesus, N-HA tag CG90446-NY
GABARAP cDNA ORF Clone, Rhesus, C-Myc tag CG90446-CM
GABARAP cDNA ORF Clone, Rhesus, N-Myc tag CG90446-NM

GABARAP cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
GABARAP cDNA ORF Clone in Cloning Vector, Rabbit TG65077-G
GABARAP cDNA ORF Clone, Rabbit, untagged TG65077-UT
GABARAP Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65077-ACGLN
GABARAP cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65077-ACG
GABARAP cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65077-ANG
GABARAP cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65077-ACR
GABARAP cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65077-ANR
GABARAP cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65077-CF
GABARAP cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65077-NF
GABARAP cDNA ORF Clone, Rabbit, C-His tag TG65077-CH
GABARAP cDNA ORF Clone, Rabbit, N-His tag TG65077-NH
GABARAP cDNA ORF Clone, Rabbit, C-HA tag TG65077-CY
GABARAP cDNA ORF Clone, Rabbit, N-HA tag TG65077-NY
GABARAP cDNA ORF Clone, Rabbit, C-Myc tag TG65077-CM
GABARAP cDNA ORF Clone, Rabbit, N-Myc tag TG65077-NM

GABARAP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GABARAP cDNA ORF Clone in Cloning Vector, Mouse MG59378-U
GABARAP cDNA ORF Clone, Mouse, untagged MG59378-UT
GABARAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59378-ACG
GABARAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59378-ACGLN
GABARAP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG59378-ANG
GABARAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59378-ACR
GABARAP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG59378-ANR
GABARAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59378-CF
GABARAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59378-NF
GABARAP cDNA ORF Clone, Mouse, C-His tag MG59378-CH
GABARAP cDNA ORF Clone, Mouse, N-His tag MG59378-NH
GABARAP cDNA ORF Clone, Mouse, C-HA tag MG59378-CY
GABARAP cDNA ORF Clone, Mouse, N-HA tag MG59378-NY
GABARAP cDNA ORF Clone, Mouse, C-Myc tag MG59378-CM
GABARAP cDNA ORF Clone, Mouse, N-Myc tag MG59378-NM

GABARAP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GABARAP cDNA ORF Clone in Cloning Vector, Human HG15622-G
GABARAP cDNA ORF Clone, Human, untagged HG15622-UT
GABARAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15622-ACGLN
GABARAP cDNA ORF Clone, Human, C-GFPSpark® tag HG15622-ACG
GABARAP cDNA ORF Clone, Human, N-GFPSpark® tag HG15622-ANG
GABARAP cDNA ORF Clone, Human, C-OFPSpark® tag HG15622-ACR
GABARAP cDNA ORF Clone, Human, N-OFPSpark® tag HG15622-ANR
GABARAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15622-CF
GABARAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15622-NF
GABARAP cDNA ORF Clone, Human, C-His tag HG15622-CH
GABARAP cDNA ORF Clone, Human, N-His tag HG15622-NH
GABARAP cDNA ORF Clone, Human, C-HA tag HG15622-CY
GABARAP cDNA ORF Clone, Human, N-HA tag HG15622-NY
GABARAP cDNA ORF Clone, Human, C-Myc tag HG15622-CM
GABARAP cDNA ORF Clone, Human, N-Myc tag HG15622-NM
GABARAP qPCR Primer Pairs, Human HP104240
info info
添加购物车成功! 添加购物车失败!