EIF6 cDNA ORF Clone, Cynomolgus, N-HA tag

Cat: CG90408-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All EIF6 Reagents

CRO Services

Product recommended


All EIF6 Reagents

EIF6 cDNA ORF Clone, Cynomolgus, N-HA tag General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
738 bp
Description
Full length Clone DNA of Cynomolgus eukaryotic translation initiation factor 6 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EIF6 Background Information

Full Name
eukaryotic translation initiation factor 6

EIF6 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
EIF6 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90408-G
EIF6 cDNA ORF Clone, Cynomolgus, untagged CG90408-UT
EIF6 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90408-ACG
EIF6 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90408-ACGLN
EIF6 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90408-ANG
EIF6 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90408-ACR
EIF6 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90408-ANR
EIF6 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90408-CF
EIF6 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90408-NF
EIF6 cDNA ORF Clone, Cynomolgus, C-His tag CG90408-CH
EIF6 cDNA ORF Clone, Cynomolgus, N-His tag CG90408-NH
EIF6 cDNA ORF Clone, Cynomolgus, C-HA tag CG90408-CY
EIF6 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90408-CM
EIF6 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90408-NM

EIF6 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
EIF6 cDNA ORF Clone in Cloning Vector, Rat RG8A4462-U
EIF6 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4462-ACGLN

EIF6 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
EIF6 cDNA ORF Clone in Cloning Vector, Mouse MG53164-G
EIF6 cDNA ORF Clone, Mouse, untagged MG53164-UT
EIF6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53164-ACGLN
EIF6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53164-ACG
EIF6 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53164-ANG
EIF6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53164-ACR
EIF6 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53164-ANR
EIF6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53164-CF
EIF6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53164-NF
EIF6 cDNA ORF Clone, Mouse, C-His tag MG53164-CH
EIF6 cDNA ORF Clone, Mouse, N-His tag MG53164-NH
EIF6 cDNA ORF Clone, Mouse, C-HA tag MG53164-CY
EIF6 cDNA ORF Clone, Mouse, N-HA tag MG53164-NY
EIF6 cDNA ORF Clone, Mouse, C-Myc tag MG53164-CM
EIF6 cDNA ORF Clone, Mouse, N-Myc tag MG53164-NM

EIF6 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
EIF6 cDNA ORF Clone in Cloning Vector, Human HG16195-G
EIF6 cDNA ORF Clone, Human, untagged HG16195-UT
EIF6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16195-ACGLN
EIF6 cDNA ORF Clone, Human, C-GFPSpark® tag HG16195-ACG
EIF6 cDNA ORF Clone, Human, N-GFPSpark® tag HG16195-ANG
EIF6 cDNA ORF Clone, Human, C-OFPSpark® tag HG16195-ACR
EIF6 cDNA ORF Clone, Human, N-OFPSpark® tag HG16195-ANR
EIF6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16195-CF
EIF6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16195-NF
EIF6 cDNA ORF Clone, Human, C-His tag HG16195-CH
EIF6 cDNA ORF Clone, Human, N-His tag HG16195-NH
EIF6 cDNA ORF Clone, Human, C-HA tag HG16195-CY
EIF6 cDNA ORF Clone, Human, N-HA tag HG16195-NY
EIF6 cDNA ORF Clone, Human, C-Myc tag HG16195-CM
EIF6 cDNA ORF Clone, Human, N-Myc tag HG16195-NM
EIF6 qPCR Primer Pairs, Human HP104963
info info
添加购物车成功! 添加购物车失败!