CDK5RAP3 cDNA ORF Clone, Rhesus, untagged

Cat: CG90734-UT

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All CDK5RAP3 Reagents

CRO Services

Product recommended


All CDK5RAP3 Reagents

CDK5RAP3 cDNA ORF Clone, Rhesus, untagged General Information

Gene

Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
1521 bp
Description
Full length Clone DNA of Rhesus CDK5 regulatory subunit associated protein 3.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CDK5RAP3 Background Information

Full Name
CDK5 regulatory subunit associated protein 3

CDK5RAP3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
CDK5RAP3 cDNA ORF Clone in Cloning Vector, Rhesus CG90734-G
CDK5RAP3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90734-ACGLN
CDK5RAP3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90734-ACG
CDK5RAP3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90734-ANG
CDK5RAP3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90734-ACR
CDK5RAP3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90734-ANR
CDK5RAP3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90734-CF
CDK5RAP3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90734-NF
CDK5RAP3 cDNA ORF Clone, Rhesus, C-His tag CG90734-CH
CDK5RAP3 cDNA ORF Clone, Rhesus, N-His tag CG90734-NH
CDK5RAP3 cDNA ORF Clone, Rhesus, C-HA tag CG90734-CY
CDK5RAP3 cDNA ORF Clone, Rhesus, N-HA tag CG90734-NY
CDK5RAP3 cDNA ORF Clone, Rhesus, C-Myc tag CG90734-CM
CDK5RAP3 cDNA ORF Clone, Rhesus, N-Myc tag CG90734-NM

CDK5RAP3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CDK5RAP3 cDNA ORF Clone in Cloning Vector, Rat RG81180-U
CDK5RAP3 cDNA ORF Clone, Rat, untagged RG81180-UT
CDK5RAP3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81180-ACG
CDK5RAP3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81180-ACGLN
CDK5RAP3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81180-ANG
CDK5RAP3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81180-ACR
CDK5RAP3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81180-ANR
CDK5RAP3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81180-CF
CDK5RAP3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81180-NF
CDK5RAP3 cDNA ORF Clone, Rat, C-His tag RG81180-CH
CDK5RAP3 cDNA ORF Clone, Rat, N-His tag RG81180-NH
CDK5RAP3 cDNA ORF Clone, Rat, C-HA tag RG81180-CY
CDK5RAP3 cDNA ORF Clone, Rat, N-HA tag RG81180-NY
CDK5RAP3 cDNA ORF Clone, Rat, C-Myc tag RG81180-CM
CDK5RAP3 cDNA ORF Clone, Rat, N-Myc tag RG81180-NM
CDK5RAP3 qPCR Primer Pairs, Rat RP301136

CDK5RAP3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CDK5RAP3 cDNA ORF Clone in Cloning Vector, Mouse MG52956-G
CDK5RAP3 cDNA ORF Clone, Mouse, untagged MG52956-UT
CDK5RAP3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52956-ACG
CDK5RAP3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52956-ACGLN
CDK5RAP3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52956-ANG
CDK5RAP3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52956-ACR
CDK5RAP3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52956-ANR
CDK5RAP3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52956-CF
CDK5RAP3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52956-NF
CDK5RAP3 cDNA ORF Clone, Mouse, C-His tag MG52956-CH
CDK5RAP3 cDNA ORF Clone, Mouse, N-His tag MG52956-NH
CDK5RAP3 cDNA ORF Clone, Mouse, C-HA tag MG52956-CY
CDK5RAP3 cDNA ORF Clone, Mouse, N-HA tag MG52956-NY
CDK5RAP3 cDNA ORF Clone, Mouse, C-Myc tag MG52956-CM
CDK5RAP3 cDNA ORF Clone, Mouse, N-Myc tag MG52956-NM

CDK5RAP3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CDK5RAP3 cDNA ORF Clone, Human, untagged HG19540-UT
info info
添加购物车成功! 添加购物车失败!