CD33 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag

Cat: CG90183-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CD33 Reagents
CRO Services
Product recommended

All CD33 Reagents
CD33 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag General Information
Gene
Species
Rhesus
NCBI Ref Seq
RefSeq ORF Size
699 bp
Description
Full length Clone DNA of Rhesus CD33 molecule with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CD33 Background Information

Myeloid cell surface antigen CD33 also known as Sialic acid binding Ig-like lectin 3, CD33 antigen or Siglec-3, is a member of the immunoglobulin superfamily and SIGLEC (sialic acid binding Ig-like lectin) family. This Single-pass type I membrane protein contains 1 Ig-like C2-type (immunoglobulin-like) domain and 1 Ig-like V-type (immunoglobulin-like) domain. CD33 /Siglec-3 is a putative adhesion molecule of myelomonocytic-derived cells that mediates sialic-acid dependent binding to cells. CD33 /Siglec-3 preferentially binds to alpha-2,6-linked sialic acid. The sialic acid recognition site may be masked by cis interactions with sialic acids on the same cell surface. In the immune response, may act as an inhibitory receptor upon ligand induced tyrosine phosphorylation by recruiting cytoplasmic phosphatase(s) via their SH2 domain(s) that block signal transduction through dephosphorylation of signaling molecules. CD33/Siglec-3 induces apoptosis in acute myeloid leukemia (in vitro). CD33/Siglec-3 can function as a sialic acid-dependent cell adhesion molecule and that binding can be modulated by endogenous sialoglycoconjugates when CD33 is expressed in a plasma membrane.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
CD33 molecule
References
  • Simmons D, et al. (1988) Isolation of a cDNA encoding CD33, a differentiation antigen of myeloid progenitor cells. J Immunol. 141(8): 2797-800.
  • Ulyanova T, et al. (1999) The sialoadhesin CD33 is a myeloid-specific inhibitory receptor. Eur J Immunol. 29(11): 3440-9.
  • Freeman SD, et al. (1995) Characterization of CD33 as a new member of the sialoadhesin family of cellular interaction molecules. Blood. 85(8): 2005-12.
  • CD33 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    CD33 cDNA ORF Clone in Cloning Vector, Rhesus CG90183-G
    CD33 cDNA ORF Clone, Rhesus, untagged CG90183-UT
    CD33 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90183-ACGLN
    CD33 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90183-ACG
    CD33 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90183-ACR
    CD33 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90183-NF
    CD33 cDNA ORF Clone, Rhesus, C-His tag CG90183-CH
    CD33 cDNA ORF Clone, Rhesus, N-His tag CG90183-NH
    CD33 cDNA ORF Clone, Rhesus, C-HA tag CG90183-CY
    CD33 cDNA ORF Clone, Rhesus, N-HA tag CG90183-NY
    CD33 cDNA ORF Clone, Rhesus, C-Myc tag CG90183-CM
    CD33 cDNA ORF Clone, Rhesus, N-Myc tag CG90183-NM

    CD33 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CD33 cDNA ORF Clone in Cloning Vector, Mouse MG50712-G
    CD33 cDNA ORF Clone, Mouse, untagged MG50712-UT
    CD33 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50712-ACGLN
    CD33 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50712-ACG
    CD33 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50712-ACR
    CD33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50712-CF
    CD33 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50712-NF
    CD33 cDNA ORF Clone, Mouse, C-His tag MG50712-CH
    CD33 cDNA ORF Clone, Mouse, N-His tag MG50712-NH
    CD33 cDNA ORF Clone, Mouse, C-HA tag MG50712-CY
    CD33 cDNA ORF Clone, Mouse, N-HA tag MG50712-NY
    CD33 cDNA ORF Clone, Mouse, C-Myc tag MG50712-CM
    CD33 cDNA ORF Clone, Mouse, N-Myc tag MG50712-NM
    CD33 qPCR Primer Pairs, Mouse MP200687

    CD33 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CD33 cDNA ORF Clone in Cloning Vector, Human HG12238-G
    CD33 cDNA ORF Clone, Human, untagged HG12238-UT
    CD33 cDNA ORF Clone, Human, C-GFPSpark® tag HG12238-ACG
    CD33 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12238-ACGLN
    CD33 cDNA ORF Clone, Human, C-OFPSpark® tag HG12238-ACR
    CD33 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12238-CF
    CD33 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12238-NF
    CD33 cDNA ORF Clone, Human, C-His tag HG12238-CH
    CD33 cDNA ORF Clone, Human, N-His tag HG12238-NH
    CD33 cDNA ORF Clone, Human, C-HA tag HG12238-CY
    CD33 cDNA ORF Clone, Human, N-HA tag HG12238-NY
    CD33 cDNA ORF Clone, Human, C-Myc tag HG12238-CM
    CD33 cDNA ORF Clone, Human, N-Myc tag HG12238-NM
    CD33 qPCR Primer Pairs, Human HP103201
    info info
    添加购物车成功! 添加购物车失败!