FE65/APBB1 cDNA ORF Clone, Cynomolgus, N-HA tag

Cat: CG90407-NY

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All FE65/APBB1 Reagents

CRO Services

Product recommended


All FE65/APBB1 Reagents

FE65/APBB1 cDNA ORF Clone, Cynomolgus, N-HA tag General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
2133 bp
Description
Full length Clone DNA of Cynomolgus amyloid beta (A4) precursor protein-binding, family B, member 1 (Fe65) with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

FE65/APBB1 Background Information

Full Name
amyloid beta precursor protein binding family B member 1

FE65/APBB1 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
FE65/APBB1 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90407-G
FE65/APBB1 cDNA ORF Clone, Cynomolgus, untagged CG90407-UT
FE65/APBB1 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90407-ACG
FE65/APBB1 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90407-ACGLN
FE65/APBB1 cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90407-ANG
FE65/APBB1 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90407-ACR
FE65/APBB1 cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90407-ANR
FE65/APBB1 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90407-CF
FE65/APBB1 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90407-NF
FE65/APBB1 cDNA ORF Clone, Cynomolgus, C-His tag CG90407-CH
FE65/APBB1 cDNA ORF Clone, Cynomolgus, N-His tag CG90407-NH
FE65/APBB1 cDNA ORF Clone, Cynomolgus, C-HA tag CG90407-CY
FE65/APBB1 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90407-CM
FE65/APBB1 cDNA ORF Clone, Cynomolgus, N-Myc tag CG90407-NM

FE65/APBB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
FE65/APBB1 cDNA ORF Clone in Cloning Vector, Mouse MG51732-G
FE65/APBB1 cDNA ORF Clone, Mouse, untagged MG51732-UT
FE65/APBB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51732-ACG
FE65/APBB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51732-ACGLN
FE65/APBB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51732-ANG
FE65/APBB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51732-ACR
FE65/APBB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51732-ANR
FE65/APBB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51732-CF
FE65/APBB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51732-NF
FE65/APBB1 cDNA ORF Clone, Mouse, C-His tag MG51732-CH
FE65/APBB1 cDNA ORF Clone, Mouse, N-His tag MG51732-NH
FE65/APBB1 cDNA ORF Clone, Mouse, C-HA tag MG51732-CY
FE65/APBB1 cDNA ORF Clone, Mouse, N-HA tag MG51732-NY
FE65/APBB1 cDNA ORF Clone, Mouse, C-Myc tag MG51732-CM
FE65/APBB1 cDNA ORF Clone, Mouse, N-Myc tag MG51732-NM
FE65/APBB1 qPCR Primer Pairs, Mouse MP201605

FE65/APBB1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
FE65/APBB1 cDNA ORF Clone in Cloning Vector, Human HG18105-U
FE65/APBB1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18105-ACGLN
info info
添加购物车成功! 添加购物车失败!