1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, N-Myc tag

Cat: CG90655-NM

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All 1-AGP acyltransferase 4/AGPAT4 Reagents

CRO Services

Product recommended


All 1-AGP acyltransferase 4/AGPAT4 Reagents

1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, N-Myc tag General Information

Gene

Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1137 bp
Description
Full length Clone DNA of Cynomolgus 1-acyl-sn-glycerol-3-phosphate acyltransferase delta with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

1-AGP acyltransferase 4/AGPAT4 Background Information

Full Name
1-acylglycerol-3-phosphate O-acyltransferase 4

1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone in Cloning Vector, Cynomolgus CG90655-G
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, untagged CG90655-UT
1-AGP acyltransferase 4/AGPAT4 Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90655-ACGLN
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90655-ACG
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90655-ACR
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90655-CF
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90655-NF
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, C-His tag CG90655-CH
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, N-His tag CG90655-NH
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, C-HA tag CG90655-CY
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, N-HA tag CG90655-NY
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Cynomolgus, C-Myc tag CG90655-CM

1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone in Cloning Vector, Mouse MG53048-G
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, untagged MG53048-UT
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53048-ACG
1-AGP acyltransferase 4/AGPAT4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53048-ACGLN
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53048-ANG
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53048-ACR
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53048-ANR
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53048-CF
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53048-NF
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, C-His tag MG53048-CH
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, N-His tag MG53048-NH
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, C-HA tag MG53048-CY
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, N-HA tag MG53048-NY
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, C-Myc tag MG53048-CM
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Mouse, N-Myc tag MG53048-NM

1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone in Cloning Vector, Human HG15316-G
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, untagged HG15316-UT
1-AGP acyltransferase 4/AGPAT4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15316-ACGLN
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, C-GFPSpark® tag HG15316-ACG
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, C-OFPSpark® tag HG15316-ACR
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15316-CF
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15316-NF
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, C-His tag HG15316-CH
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, N-His tag HG15316-NH
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, C-HA tag HG15316-CY
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, N-HA tag HG15316-NY
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, C-Myc tag HG15316-CM
1-AGP acyltransferase 4/AGPAT4 cDNA ORF Clone, Human, N-Myc tag HG15316-NM
1-AGP acyltransferase 4/AGPAT4 qPCR Primer Pairs, Human HP103941
info info
添加购物车成功! 添加购物车失败!