Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, N-His tag

Cat: CG90607-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Actin-like protein 6B/BAF53b Reagents
CRO Services
Product recommended

All Actin-like protein 6B/BAF53b Reagents
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, N-His tag General Information
Gene
Species
Cynomolgus
NCBI Ref Seq
RefSeq ORF Size
1281 bp
Description
Full length Clone DNA of Cynomolgus actin-like 6B with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Actin-like protein 6B/BAF53b Background Information
Full Name
actin-like 6B

Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
Actin-like protein 6B/BAF53b cDNA ORF Clone in Cloning Vector, Cynomolgus CG90607-G
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, untagged CG90607-UT
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90607-ACG
Actin-like protein 6B/BAF53b Lentiviral cDNA ORF Clone, Cynomolgus, C-GFPSpark® tag CG90607-ACGLN
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, N-GFPSpark® tag CG90607-ANG
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, C-OFPSpark® tag CG90607-ACR
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, N-OFPSpark® tag CG90607-ANR
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90607-CF
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, N-DDK (Flag®) tag CG90607-NF
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, C-His tag CG90607-CH
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, C-HA tag CG90607-CY
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, N-HA tag CG90607-NY
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, C-Myc tag CG90607-CM
Actin-like protein 6B/BAF53b cDNA ORF Clone, Cynomolgus, N-Myc tag CG90607-NM

Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Actin-like protein 6B/BAF53b cDNA ORF Clone in Cloning Vector, Mouse MG52380-G
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, untagged MG52380-UT
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52380-ACG
Actin-like protein 6B/BAF53b Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52380-ACGLN
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52380-ANG
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52380-ACR
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52380-ANR
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52380-CF
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52380-NF
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, C-His tag MG52380-CH
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, N-His tag MG52380-NH
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, C-HA tag MG52380-CY
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, N-HA tag MG52380-NY
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, C-Myc tag MG52380-CM
Actin-like protein 6B/BAF53b cDNA ORF Clone, Mouse, N-Myc tag MG52380-NM
Actin-like protein 6B/BAF53b qPCR Primer Pairs, Mouse MP202253

Actin-like protein 6B/BAF53b cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Actin-like protein 6B/BAF53b cDNA ORF Clone, Human, untagged HG18220-UT
info info
添加购物车成功! 添加购物车失败!