Stathmin 1 cDNA ORF Clone, Canine, C-His tag

Cat: DG70212-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Stathmin 1 Reagents
CRO Services
Product recommended

All Stathmin 1 Reagents
Stathmin 1 cDNA ORF Clone, Canine, C-His tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
450 bp
Description
Full length Clone DNA of Canine stathmin 1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Stathmin 1 Background Information
Full Name
stathmin 1

Stathmin 1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Stathmin 1 cDNA ORF Clone in Cloning Vector, Canine DG70212-U
Stathmin 1 cDNA ORF Clone, Canine, untagged DG70212-UT
Stathmin 1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70212-ACG
Stathmin 1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70212-ACGLN
Stathmin 1 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70212-ANG
Stathmin 1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70212-ACR
Stathmin 1 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70212-ANR
Stathmin 1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70212-CF
Stathmin 1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70212-NF
Stathmin 1 cDNA ORF Clone, Canine, N-His tag DG70212-NH
Stathmin 1 cDNA ORF Clone, Canine, C-HA tag DG70212-CY
Stathmin 1 cDNA ORF Clone, Canine, N-HA tag DG70212-NY
Stathmin 1 cDNA ORF Clone, Canine, C-Myc tag DG70212-CM
Stathmin 1 cDNA ORF Clone, Canine, N-Myc tag DG70212-NM

Stathmin 1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Stathmin 1 cDNA ORF Clone in Cloning Vector, Rat RG82995-U
Stathmin 1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG82995-ACGLN

Stathmin 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Stathmin 1 cDNA ORF Clone in Cloning Vector, Mouse MG52183-G
Stathmin 1 cDNA ORF Clone, Mouse, untagged MG52183-UT
Stathmin 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52183-ACGLN
Stathmin 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52183-ACG
Stathmin 1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52183-ANG
Stathmin 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52183-ACR
Stathmin 1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52183-ANR
Stathmin 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52183-CF
Stathmin 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52183-NF
Stathmin 1 cDNA ORF Clone, Mouse, C-His tag MG52183-CH
Stathmin 1 cDNA ORF Clone, Mouse, N-His tag MG52183-NH
Stathmin 1 cDNA ORF Clone, Mouse, C-HA tag MG52183-CY
Stathmin 1 cDNA ORF Clone, Mouse, N-HA tag MG52183-NY
Stathmin 1 cDNA ORF Clone, Mouse, C-Myc tag MG52183-CM
Stathmin 1 cDNA ORF Clone, Mouse, N-Myc tag MG52183-NM
Stathmin 1 qPCR Primer Pairs, Mouse MP202056

Stathmin 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Stathmin 1 cDNA ORF Clone in Cloning Vector, Human HG15440-G
Stathmin 1 cDNA ORF Clone, Human, untagged HG15440-UT
Stathmin 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG15440-ACG
Stathmin 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15440-ACGLN
Stathmin 1 cDNA ORF Clone, Human, N-GFPSpark® tag HG15440-ANG
Stathmin 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG15440-ACR
Stathmin 1 cDNA ORF Clone, Human, N-OFPSpark® tag HG15440-ANR
Stathmin 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15440-CF
Stathmin 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15440-NF
Stathmin 1 cDNA ORF Clone, Human, C-His tag HG15440-CH
Stathmin 1 cDNA ORF Clone, Human, N-His tag HG15440-NH
Stathmin 1 cDNA ORF Clone, Human, C-HA tag HG15440-CY
Stathmin 1 cDNA ORF Clone, Human, N-HA tag HG15440-NY
Stathmin 1 cDNA ORF Clone, Human, C-Myc tag HG15440-CM
Stathmin 1 cDNA ORF Clone, Human, N-Myc tag HG15440-NM
Stathmin 1 qPCR Primer Pairs, Human HP104064
info info
添加购物车成功! 添加购物车失败!