IL-8 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70009-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All IL-8 Reagents

CRO Services

Product recommended


All IL-8 Reagents

IL-8 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information

Gene

Species
Canine
NCBI Ref Seq
RefSeq ORF Size
306 bp
Description
Full length Clone DNA of Canine interleukin 8 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-8 Background Information

Interleukin 8 (IL-8), also known as CXCL8, which is a chemokine with a defining CXC amino acid motif that was initially characterized for its leukocyte chemotactic activity, is now known to possess tumorigenic and proangiogenic properties as well. This chemokine is secreted by a variety of cell types including monocyte/macrophages, T cells, neutrophils, fibroblasts, endothelial cells, and various tumor cell lines in response to inflammatory stimuli (IL1, TNF, LPS, etc). In human gliomas, IL-8 is expressed and secreted at high levels both in vitro and in vivo, and recent experiments suggest it is critical to glial tumor neovascularity and progression. Levels of IL-8 correlate with histologic grade in glial neoplasms, and the most malignant form, glioblastoma, shows the highest expression in pseudopalisading cells around necrosis, suggesting that hypoxia/anoxia may stimulate expression. Interleukin (IL)-8/CXCL8 is a potent neutrophil chemotactic factor. Accumulating evidence has demonstrated that various types of cells can produce a large amount of IL-8/CXCL8 in response to a wide variety of stimuli, including proinflammatory cytokines, microbes and their products, and environmental changes such as hypoxia, reperfusion, and hyperoxia. Numerous observations have established IL-8/CXCL8 as a key mediator in neutrophil-mediated acute inflammation due to its potent actions on neutrophils. However, several lines of evidence indicate that IL-8/CXCL8 has a wide range of actions on various types of cells, including lymphocytes, monocytes, endothelial cells, and fibroblasts, besides neutrophils. The discovery of these biological functions suggests that IL-8/CXCL8 has crucial roles in various pathological conditions such as chronic inflammation and cancer. IL-8 has been associated with tumor angiogenesis, metastasis, and poor prognosis in breast cancer. IL-8 may present a novel therapeutic target for estrogen driven breast carcinogenesis and tumor progression.

Full Name
chemokine (C-X-C motif) ligand 8
References
  • Mukaida N. (2003) Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases. Am J Physiol Lung Cell Mol Physiol. 284(4): L566-77.
  • Brat DJ, et al. (2005) The role of interleukin-8 and its receptors in gliomagenesis and tumoral angiogenesis. Neuro Oncol. 7(2): 122-33.
  • Bendrik C, et al. (2009) Estradiol increases IL-8 secretion of normal human breast tissue and breast cancer in vivo. J Immunol. 182(1): 371-8.
  • IL-8 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL-8 cDNA ORF Clone in Cloning Vector, Rhesus CG90280-G
    IL-8 cDNA ORF Clone, Rhesus, untagged CG90280-UT
    IL-8 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90280-ACGLN
    IL-8 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90280-ACG
    IL-8 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90280-ACR
    IL-8 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90280-CF
    IL-8 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90280-NF
    IL-8 cDNA ORF Clone, Rhesus, C-His tag CG90280-CH
    IL-8 cDNA ORF Clone, Rhesus, N-His tag CG90280-NH
    IL-8 cDNA ORF Clone, Rhesus, C-HA tag CG90280-CY
    IL-8 cDNA ORF Clone, Rhesus, N-HA tag CG90280-NY
    IL-8 cDNA ORF Clone, Rhesus, C-Myc tag CG90280-CM
    IL-8 cDNA ORF Clone, Rhesus, N-Myc tag CG90280-NM

    IL-8 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL-8 cDNA ORF Clone in Cloning Vector, Canine DG70009-M
    IL-8 cDNA ORF Clone, Canine, untagged DG70009-UT
    IL-8 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70009-ACG
    IL-8 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70009-ACGLN
    IL-8 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70009-ACR
    IL-8 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70009-NF
    IL-8 cDNA ORF Clone, Canine, C-His tag DG70009-CH
    IL-8 cDNA ORF Clone, Canine, N-His tag DG70009-NH
    IL-8 cDNA ORF Clone, Canine, C-HA tag DG70009-CY
    IL-8 cDNA ORF Clone, Canine, N-HA tag DG70009-NY
    IL-8 cDNA ORF Clone, Canine, C-Myc tag DG70009-CM
    IL-8 cDNA ORF Clone, Canine, N-Myc tag DG70009-NM

    IL-8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-8 cDNA ORF Clone in Cloning Vector, Human HG10098-M
    IL-8 cDNA ORF Clone, Human, untagged HG10098-UT
    IL-8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10098-ACGLN
    IL-8 cDNA ORF Clone, Human, C-GFPSpark® tag HG10098-ACG
    IL-8 cDNA ORF Clone, Human, C-OFPSpark® tag HG10098-ACR
    IL-8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10098-CF
    IL-8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10098-NF
    IL-8 cDNA ORF Clone, Human, C-His tag HG10098-CH
    IL-8 cDNA ORF Clone, Human, N-His tag HG10098-NH
    IL-8 cDNA ORF Clone, Human, C-HA tag HG10098-CY
    IL-8 cDNA ORF Clone, Human, N-HA tag HG10098-NY
    IL-8 cDNA ORF Clone, Human, C-Myc tag HG10098-CM
    IL-8 cDNA ORF Clone, Human, N-Myc tag HG10098-NM
    IL-8 qPCR Primer Pairs, Human HP100179
    info info
    添加购物车成功! 添加购物车失败!