IGF1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70037-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IGF1 Reagents
CRO Services
Product recommended

All IGF1 Reagents
IGF1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
462 bp
Description
Full length Clone DNA of Canine insulin-like growth factor 1 (somatomedin C) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGF1 Background Information

IGF I, also known as mechano growth factor, somatomedin-C, IGF-I and IGF1, is a secreted protein which belongs to the?insulin family. The insulin family, comprised of insulin, relaxin, insulin-like growth factors I and II ( IGF-I and IGF-II ) and possibly the beta-subunit of 7S nerve growth factor, represents a group of structurally related polypeptides whose biological functions have diverged. The IGFs, or somatomedins, constitute a class of polypeptides that have a key role in pre-adolescent mammalian growth. IGF-I expression is regulated by GH and mediates postnatal growth, while IGF-II appears to be induced by placental lactogen during prenatal development. IGF1 / IGF-I may be a physiological regulator of [1-14C]-2-deoxy-D-glucose (2DG) transport and glycogen synthesis in osteoblasts. IGF1 / IGF-I stimulates glucose transport in rat bone-derived osteoblastic (PyMS) cells and is effective at much lower concentrations than insulin, not only regarding glycogen and DNA synthesis but also with regard to enhancing glucose uptake. Defects in IGF1 / IGF-I are the cause of insulin-like growth factor I deficiency (IGF1 deficiency) which is an autosomal recessive disorder characterized by growth retardation, sensorineural deafness and mental retardation.

Full Name
insulin-like growth factor 1 (somatomedin C)
References
  • Jansen M., et al.,(1983), Sequence of cDNA encoding human insulin-like growth factor I precursor. Nature 306:609-611.
  • de Pagter-Holthuizen P., et al., (1986), Organization of the human genes for insulin-like growth factors I and II.FEBS Lett. 195:179-184.
  • le Bouc Y., et al.,(1986), Complete characterization of the human IGF-I nucleotide sequence isolated from a newly constructed adult liver cDNA library.FEBS Lett. 196:108-112.
  • IGF1 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IGF1 cDNA ORF Clone in Cloning Vector, Canine DG70037-G
    IGF1 cDNA ORF Clone, Canine, untagged DG70037-UT
    IGF1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70037-ACG
    IGF1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70037-ACGLN
    IGF1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70037-ACR
    IGF1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70037-NF
    IGF1 cDNA ORF Clone, Canine, C-His tag DG70037-CH
    IGF1 cDNA ORF Clone, Canine, N-His tag DG70037-NH
    IGF1 cDNA ORF Clone, Canine, C-HA tag DG70037-CY
    IGF1 cDNA ORF Clone, Canine, N-HA tag DG70037-NY
    IGF1 cDNA ORF Clone, Canine, C-Myc tag DG70037-CM
    IGF1 cDNA ORF Clone, Canine, N-Myc tag DG70037-NM

    IGF1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IGF1 cDNA ORF Clone in Cloning Vector, Rat RG80503-U
    IGF1 cDNA ORF Clone, Rat, untagged RG80503-UT
    IGF1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80503-ACG
    IGF1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80503-ACGLN
    IGF1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80503-ACR
    IGF1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80503-CF
    IGF1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80503-NF
    IGF1 cDNA ORF Clone, Rat, C-His tag RG80503-CH
    IGF1 cDNA ORF Clone, Rat, N-His tag RG80503-NH
    IGF1 cDNA ORF Clone, Rat, C-HA tag RG80503-CY
    IGF1 cDNA ORF Clone, Rat, N-HA tag RG80503-NY
    IGF1 cDNA ORF Clone, Rat, C-Myc tag RG80503-CM
    IGF1 cDNA ORF Clone, Rat, N-Myc tag RG80503-NM
    IGF1 qPCR Primer Pairs, Rat RP300467

    IGF1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IGF1 cDNA ORF Clone in Cloning Vector, Mouse MG50437-M
    IGF1 cDNA ORF Clone, Mouse, untagged MG50437-UT
    IGF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50437-ACGLN
    IGF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50437-ACG
    IGF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50437-ACR
    IGF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50437-CF
    IGF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50437-NF
    IGF1 cDNA ORF Clone, Mouse, C-His tag MG50437-CH
    IGF1 cDNA ORF Clone, Mouse, N-His tag MG50437-NH
    IGF1 cDNA ORF Clone, Mouse, C-HA tag MG50437-CY
    IGF1 cDNA ORF Clone, Mouse, N-HA tag MG50437-NY
    IGF1 cDNA ORF Clone, Mouse, C-Myc tag MG50437-CM
    IGF1 cDNA ORF Clone, Mouse, N-Myc tag MG50437-NM
    IGF1 qPCR Primer Pairs, Mouse MP200446

    IGF1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IGF1 cDNA ORF Clone in Cloning Vector, Human HG29626-G
    IGF1 cDNA ORF Clone in Cloning Vector, Human HG10598-G
    IGF1 cDNA ORF Clone, Human, untagged HG10598-UT
    IGF1 cDNA ORF Clone, Human, untagged HG29626-UT
    IGF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10598-ACGLN
    IGF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG29626-ACG
    IGF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10598-ACG
    IGF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29626-ACGLN
    IGF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10598-ACR
    IGF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG29626-ACR
    IGF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10598-CF
    IGF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG29626-CF
    IGF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG29626-NF
    IGF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10598-NF
    IGF1 cDNA ORF Clone, Human, C-His tag HG29626-CH
    IGF1 cDNA ORF Clone, Human, C-His tag HG10598-CH
    IGF1 cDNA ORF Clone, Human, N-His tag HG29626-NH
    IGF1 cDNA ORF Clone, Human, N-His tag HG10598-NH
    IGF1 cDNA ORF Clone, Human, C-HA tag HG10598-CY
    IGF1 cDNA ORF Clone, Human, C-HA tag HG29626-CY
    IGF1 cDNA ORF Clone, Human, N-HA tag HG29626-NY
    IGF1 cDNA ORF Clone, Human, N-HA tag HG10598-NY
    IGF1 cDNA ORF Clone, Human, C-Myc tag HG29626-CM
    IGF1 cDNA ORF Clone, Human, C-Myc tag HG10598-CM
    IGF1 cDNA ORF Clone, Human, N-Myc tag HG29626-NM
    IGF1 cDNA ORF Clone, Human, N-Myc tag HG10598-NM
    info info
    添加购物车成功! 添加购物车失败!