GABARAPL2 cDNA ORF Clone, Canine, C-His tag

Cat: DG70191-CH

Contact us:

215-583-7898
order@sinobiological.com
Distributors

All GABARAPL2 Reagents

CRO Services

Product recommended


All GABARAPL2 Reagents

GABARAPL2 cDNA ORF Clone, Canine, C-His tag General Information

Gene

Species
Canine
NCBI Ref Seq
RefSeq ORF Size
354 bp
Description
Full length Clone DNA of Canine GABA(A) receptor-associated protein-like 2 with C terminal His tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GABARAPL2 Background Information

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

Full Name
GABA(A) receptor-associated protein-like 2
References
  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • GABARAPL2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    GABARAPL2 cDNA ORF Clone in Cloning Vector, Canine DG70191-U
    GABARAPL2 cDNA ORF Clone, Canine, untagged DG70191-UT
    GABARAPL2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70191-ACGLN
    GABARAPL2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70191-ACG
    GABARAPL2 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70191-ANG
    GABARAPL2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70191-ACR
    GABARAPL2 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70191-ANR
    GABARAPL2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70191-CF
    GABARAPL2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70191-NF
    GABARAPL2 cDNA ORF Clone, Canine, N-His tag DG70191-NH
    GABARAPL2 cDNA ORF Clone, Canine, C-HA tag DG70191-CY
    GABARAPL2 cDNA ORF Clone, Canine, N-HA tag DG70191-NY
    GABARAPL2 cDNA ORF Clone, Canine, C-Myc tag DG70191-CM
    GABARAPL2 cDNA ORF Clone, Canine, N-Myc tag DG70191-NM

    GABARAPL2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    GABARAPL2 cDNA ORF Clone in Cloning Vector, Rat RG80724-U
    GABARAPL2 cDNA ORF Clone, Rat, untagged RG80724-UT
    GABARAPL2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80724-ACGLN
    GABARAPL2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80724-ACG
    GABARAPL2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80724-ACR
    GABARAPL2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80724-CF
    GABARAPL2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80724-NF
    GABARAPL2 cDNA ORF Clone, Rat, C-His tag RG80724-CH
    GABARAPL2 cDNA ORF Clone, Rat, N-His tag RG80724-NH
    GABARAPL2 cDNA ORF Clone, Rat, C-HA tag RG80724-CY
    GABARAPL2 cDNA ORF Clone, Rat, N-HA tag RG80724-NY
    GABARAPL2 cDNA ORF Clone, Rat, C-Myc tag RG80724-CM
    GABARAPL2 cDNA ORF Clone, Rat, N-Myc tag RG80724-NM
    GABARAPL2 qPCR Primer Pairs, Rat RP300688

    GABARAPL2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    GABARAPL2 cDNA ORF Clone in Cloning Vector, Mouse MG51323-U
    GABARAPL2 cDNA ORF Clone, Mouse, untagged MG51323-UT
    GABARAPL2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51323-ACGLN
    GABARAPL2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51323-ACG
    GABARAPL2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51323-ACR
    GABARAPL2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51323-CF
    GABARAPL2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51323-NF
    GABARAPL2 cDNA ORF Clone, Mouse, C-His tag MG51323-CH
    GABARAPL2 cDNA ORF Clone, Mouse, N-His tag MG51323-NH
    GABARAPL2 cDNA ORF Clone, Mouse, C-HA tag MG51323-CY
    GABARAPL2 cDNA ORF Clone, Mouse, N-HA tag MG51323-NY
    GABARAPL2 cDNA ORF Clone, Mouse, C-Myc tag MG51323-CM
    GABARAPL2 cDNA ORF Clone, Mouse, N-Myc tag MG51323-NM
    GABARAPL2 qPCR Primer Pairs, Mouse MP201200

    GABARAPL2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    GABARAPL2 cDNA ORF Clone in Cloning Vector, Human HG14563-G
    GABARAPL2 cDNA ORF Clone, Human, untagged HG14563-UT
    GABARAPL2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14563-ACG
    GABARAPL2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14563-ACGLN
    GABARAPL2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14563-ACR
    GABARAPL2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14563-CF
    GABARAPL2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14563-NF
    GABARAPL2 cDNA ORF Clone, Human, C-His tag HG14563-CH
    GABARAPL2 cDNA ORF Clone, Human, N-His tag HG14563-NH
    GABARAPL2 cDNA ORF Clone, Human, C-HA tag HG14563-CY
    GABARAPL2 cDNA ORF Clone, Human, N-HA tag HG14563-NY
    GABARAPL2 cDNA ORF Clone, Human, C-Myc tag HG14563-CM
    GABARAPL2 cDNA ORF Clone, Human, N-Myc tag HG14563-NM
    GABARAPL2 qPCR Primer Pairs, Human HP104911
    info info
    添加购物车成功! 添加购物车失败!