CCL5 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70007-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All CCL5 Reagents

CRO Services

Product recommended


All CCL5 Reagents

CCL5 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information

Gene

Species
Canine
NCBI Ref Seq
RefSeq ORF Size
276 bp
Description
Full length Clone DNA of Canine chemokine (C-C motif) ligand 5 with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CCL5 Background Information

Chemokines are a family of small chemotactic cytokines, or proteins secreted by cells. Chemokines share the same structure similarities such as small size, and the presence of four cysteine residues in conserved locations in order to form their 3-dimensional shape. Some of the chemokines are considered pro-inflammatory which can be induced to recruit cells of the immune system to a site of infection during an immune response, while others are considered homeostatic and are implied in controlling the migration of cells during normal processes of tissue maintenance and development. There are four members of the chemokine family: C-C kemokines, C kemokines, CXC kemokines and CX3C kemokines. The C-C kemokines have two cysteines nearby the amino terminus. There have been at least 27 distinct members of this subgroup reported for mammals, called C-C chemokine ligands-1 to 28. Chemokin ligand 5(CCL5) is chemotactic for T cells, basophils and eosinophils. Chemokin ligand 5(CCL5) has been considered a HIV-supressor secreted by CD8+ T cells and other immune cells. Chemokin ligand 5(CCL5) is a key to activating recruit leukocytes into inflammatory sites and in the presence of particular cytokines released by T cells, it can change the NK cells into CHAK cells.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
chemokine (C-C motif) ligand 5
References
  • Laing KJ, et al. (2004) Chemokines. Developmental and comparative immunology. 28(5): 443-60.
  • Cocchi F, et al. (1995) Identification of RANTES, MIP-1a, and MIP-1b as the major HIV-suppressive factor produced by CD8+ T cells. Science. 270 (5243): 1811-5.
  • Vangelista L, et al. (2010) Engineering of Lactobacillus jensenii to secrete RANTES and a CCR5 antagonist analogue as live HIV-1 blockers. Antimicrob. Agents Chemother. 54 (7): 2994-3001.
  • Maghazachi AA, et al. (1996) CC chemokines induce the generation of killer cells from CD56+ cells. Eur. J. Immunol. 26 (2): 315-9.
  • CCL5 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    CCL5 cDNA ORF Clone in Cloning Vector, Canine DG70007-M
    CCL5 cDNA ORF Clone, Canine, untagged DG70007-UT
    CCL5 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70007-ACGLN
    CCL5 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70007-ACG
    CCL5 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70007-ACR
    CCL5 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70007-NF
    CCL5 cDNA ORF Clone, Canine, C-His tag DG70007-CH
    CCL5 cDNA ORF Clone, Canine, N-His tag DG70007-NH
    CCL5 cDNA ORF Clone, Canine, C-HA tag DG70007-CY
    CCL5 cDNA ORF Clone, Canine, N-HA tag DG70007-NY
    CCL5 cDNA ORF Clone, Canine, C-Myc tag DG70007-CM
    CCL5 cDNA ORF Clone, Canine, N-Myc tag DG70007-NM

    CCL5 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CCL5 cDNA ORF Clone in Cloning Vector, Rat RG80038-M
    CCL5 cDNA ORF Clone, Rat, untagged RG80038-UT
    CCL5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80038-ACG
    CCL5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80038-ACGLN
    CCL5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80038-ACR
    CCL5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80038-CF
    CCL5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80038-NF
    CCL5 cDNA ORF Clone, Rat, C-His tag RG80038-CH
    CCL5 cDNA ORF Clone, Rat, N-His tag RG80038-NH
    CCL5 cDNA ORF Clone, Rat, C-HA tag RG80038-CY
    CCL5 cDNA ORF Clone, Rat, N-HA tag RG80038-NY
    CCL5 cDNA ORF Clone, Rat, C-Myc tag RG80038-CM
    CCL5 cDNA ORF Clone, Rat, N-Myc tag RG80038-NM
    CCL5 qPCR Primer Pairs, Rat RP300037

    CCL5 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CCL5 cDNA ORF Clone in Cloning Vector, Mouse MG50022-M
    CCL5 cDNA ORF Clone, Mouse, untagged MG50022-UT
    CCL5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50022-ACG
    CCL5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50022-ACGLN
    CCL5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50022-ACR
    CCL5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50022-CF
    CCL5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50022-NF
    CCL5 cDNA ORF Clone, Mouse, C-His tag MG50022-CH
    CCL5 cDNA ORF Clone, Mouse, N-His tag MG50022-NH
    CCL5 cDNA ORF Clone, Mouse, C-HA tag MG50022-CY
    CCL5 cDNA ORF Clone, Mouse, N-HA tag MG50022-NY
    CCL5 cDNA ORF Clone, Mouse, C-Myc tag MG50022-CM
    CCL5 cDNA ORF Clone, Mouse, N-Myc tag MG50022-NM
    CCL5 qPCR Primer Pairs, Mouse MP200022

    CCL5 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CCL5 cDNA ORF Clone in Cloning Vector, Human HG10900-M
    CCL5 cDNA ORF Clone, Human, untagged HG10900-UT
    CCL5 cDNA ORF Clone, Human, C-GFPSpark® tag HG10900-ACG
    CCL5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10900-ACGLN
    CCL5 cDNA ORF Clone, Human, C-OFPSpark® tag HG10900-ACR
    CCL5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10900-CF
    CCL5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10900-NF
    CCL5 cDNA ORF Clone, Human, C-His tag HG10900-CH
    CCL5 cDNA ORF Clone, Human, N-His tag HG10900-NH
    CCL5 cDNA ORF Clone, Human, C-HA tag HG10900-CY
    CCL5 cDNA ORF Clone, Human, N-HA tag HG10900-NY
    CCL5 cDNA ORF Clone, Human, C-Myc tag HG10900-CM
    CCL5 cDNA ORF Clone, Human, N-Myc tag HG10900-NM
    CCL5 qPCR Primer Pairs, Human HP100784
    info info
    添加购物车成功! 添加购物车失败!