ANGPTL1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag

Cat: DG70032-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ANGPTL1 Reagents
CRO Services
Product recommended

All ANGPTL1 Reagents
ANGPTL1 cDNA ORF Clone, Canine, C-DDK (Flag®) tag General Information
Gene
Species
Canine
NCBI Ref Seq
RefSeq ORF Size
1476 bp
Description
Full length Clone DNA of Canine angiopoietin-like 1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ANGPTL1 Background Information
Full Name
angiopoietin-like 1

ANGPTL1 cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
ANGPTL1 cDNA ORF Clone in Cloning Vector, Canine DG70032-G
ANGPTL1 cDNA ORF Clone, Canine, untagged DG70032-UT
ANGPTL1 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70032-ACGLN
ANGPTL1 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70032-ACG
ANGPTL1 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70032-ACR
ANGPTL1 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70032-NF
ANGPTL1 cDNA ORF Clone, Canine, C-His tag DG70032-CH
ANGPTL1 cDNA ORF Clone, Canine, N-His tag DG70032-NH
ANGPTL1 cDNA ORF Clone, Canine, C-HA tag DG70032-CY
ANGPTL1 cDNA ORF Clone, Canine, N-HA tag DG70032-NY
ANGPTL1 cDNA ORF Clone, Canine, C-Myc tag DG70032-CM
ANGPTL1 cDNA ORF Clone, Canine, N-Myc tag DG70032-NM

ANGPTL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ANGPTL1 cDNA ORF Clone in Cloning Vector, Mouse MG50434-M
ANGPTL1 cDNA ORF Clone, Mouse, untagged MG50434-UT
ANGPTL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50434-ACGLN
ANGPTL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50434-ACG
ANGPTL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50434-ACR
ANGPTL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50434-CF
ANGPTL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50434-NF
ANGPTL1 cDNA ORF Clone, Mouse, C-His tag MG50434-CH
ANGPTL1 cDNA ORF Clone, Mouse, N-His tag MG50434-NH
ANGPTL1 cDNA ORF Clone, Mouse, C-HA tag MG50434-CY
ANGPTL1 cDNA ORF Clone, Mouse, N-HA tag MG50434-NY
ANGPTL1 cDNA ORF Clone, Mouse, C-Myc tag MG50434-CM
ANGPTL1 cDNA ORF Clone, Mouse, N-Myc tag MG50434-NM
ANGPTL1 qPCR Primer Pairs, Mouse MP200443

ANGPTL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ANGPTL1 cDNA ORF Clone in Cloning Vector, Human HG10776-M
ANGPTL1 cDNA ORF Clone, Human, untagged HG10776-UT
ANGPTL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10776-ACGLN
ANGPTL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10776-ACG
ANGPTL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10776-ACR
ANGPTL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10776-CF
ANGPTL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10776-NF
ANGPTL1 cDNA ORF Clone, Human, C-His tag HG10776-CH
ANGPTL1 cDNA ORF Clone, Human, N-His tag HG10776-NH
ANGPTL1 cDNA ORF Clone, Human, C-HA tag HG10776-CY
ANGPTL1 cDNA ORF Clone, Human, N-HA tag HG10776-NY
ANGPTL1 cDNA ORF Clone, Human, C-Myc tag HG10776-CM
ANGPTL1 cDNA ORF Clone, Human, N-Myc tag HG10776-NM
ANGPTL1 qPCR Primer Pairs, Human HP100696
info info
添加购物车成功! 添加购物车失败!