Adracalin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

Adracalin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1641 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens achalasia, adrenocortical insufficiency, alacrimia.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

Adracalin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

AAA cDNA ORF Clone, Human; AAASb cDNA ORF Clone, Human; ADRACALA cDNA ORF Clone, Human; ADRACALIN cDNA ORF Clone, Human; ALADIN cDNA ORF Clone, Human; GL003 cDNA ORF Clone, Human

Adracalin Background Information

Full Name
achalasia, adrenocortical insufficiency, alacrimia
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait